Premio Nobel para la “molécula de la vida” que ha puesto contra las cuerdas a la covid-19

10 minutos de lectura
white labeled vaccine bottle on blue background
Photo by Maksim Goncharenok on Pexels.com

Alfredo Corell Almuzara, Universidad de Sevilla

Se ha conocido hace escasas horas que el Instituto Karolinska de Estocolmo (Suecia) otorgaba el premio Nobel de Fisiología o Medicina en esta edición de 2023 a la bioquímica húngara Katalin Karikó y el inmunólogo estadounidense Drew Weissman por la vacuna contra la covid basada en ARN mensajero.

Sin lugar a dudas, el desarrollo fulgurante de esta estrategia de vacunación merece el galardón, y ha supuesto un hito en la historia de la medicina reciente. Apenas 40 días después de que se tuviera toda la información genética del SARS-CoV-2 aislado en Wuhan, la compañía Moderna ya disponía del prototipo de la vacuna de ARN para la covid-19. Este paso de gigante fue posible gracias al trabajo desarrollado durante décadas por los dos científicos ganadores del Nobel este año.

¿En qué se distingue esta vacuna frente a vacunas previas?

La diferencia fundamental es la sustancia que se inocula. En todas las vacunas anteriores, básicamente se introducía el agente infeccioso completo (alterado o inactivado) o porciones proteicas del mismo. En la vacuna para la covid-19 se ha inoculado material genético (en concreto ARN mensajero) del virus SARS-CoV-2 con algunas modificaciones.

Karikó y Weissman han trabajado durante décadas para que esto sea posible. Porque esta molécula de ARN tenía dos grandes problemas para ser utilizada en la terapia de vacunas: es de una extrema inestabilidad (se descompone casi con tan solo mirarla) y al ponerla en contacto con las células humanas producía graves reacciones inflamatorias, ya que el sistema inmunitario reacciona frente al ARN de un modo muy fuerte.

Justamente salvar estos dos problemas ha sido una de las grandes contribuciones de los dos investigadores:

  • Por una parte se han realizado modificaciones en los dos extremos de la molécula para que esta sea más estable.
  • Por otra parte se le ha cambiado una de las cuatro “letras de la vida”, que en el caso del ARN son “A”, “G”, “C” y “U”. Como esta última es la que produce una hiperactivación del sistema inmunitario, modificarla solventa perfectamente el problema, reduciendo la inflamación.

Otro gran hallazgo de Karikó y Weissmann fue el envoltorio que crearon para que las moléculas de ARN pudieran entrar en nuestras células. Años de desarrollo han permitido que estas “burbujas de grasas” (nanopartículas lipídicas) se fusionen con la membrana de nuestras células y se pueda introducir la molécula de ARN.

¿Como es el proceso de vacunación?

El funcionamiento de la vacunación es un hito en el conocimiento: por primera vez se consigue que nuestras células “fabriquen” las proteínas del virus, en vez de inocular el virus completo o alguna de sus proteínas. Este proceso hace que se active nuestro sistema inmunitario de un modo más potente, porque no solo pone en marcha nuestras defensas especializadas, sino que también las de primera línea reaccionan frente al RNA. Este es uno de los motivos por el que estas vacunas resultan más reactivas.

Además, el hecho de que se inyecte material genético –que no modifica ni puede modificar nuestros propios genes, porque a diferencia del ADN no se integra en el núcleo celular– hace que precisemos menos cantidad de la molécula que en otras vacunaciones.

El proceso completo está esquematizado y se entiende muy bien en este vídeo que he realizado para un curso de vacunación (que aún no está impartiéndose), que nos aclara perfectamente cualquier duda.

La molécula de la vida

El ARN se considera como la molécula más antigua que existe con capacidad para generar “vida” a partir de un caldo o sopa ancestral, y que por acción de las situaciones ambientales térmicas y las radiaciones conseguiría eventualmente “autorreproducirse”. Qué casualidad que justamente dediqué mi trabajo final de la asignatura de Biofísica en la Licenciatura de Biología a hacer una simulación programada de cómo estas moléculas se podrían reproducir en aquellas situaciones primitivas.

Hay varios subtipos de molécula de ARN:

  1. La destinada a la fabricación de las proteínas, que construye unas potentes máquinas de síntesis llamadas “ribosomas”.
  2. La destinada a añadir un nuevo eslabón de cada proteína, que se denomina ARN de transferencia.
  3. La destinada a la mensajería, que pasa la información del núcleo para fabricar las proteínas. Es justamente la que se ha utilizado en estas vacunas.

A diferencia de la otra molécula genética (ADN), el ARN es de cadena simple y únicamente tiene la información final, imprescindible para fabricar las proteínas. El ADN, además de ser de cadena doble, contiene no solo la información anterior, sino mucha otra que es necesaria para la célula y para su función, pero que se puede obviar en el proceso de sintetizar proteínas.

Conviene recordar que estas dos moléculas genéticas, ADN y ARN, se componen a su vez de cuatro moléculas básicas que, puestas consecutivas como una cadena con cuatro tipos de eslabones (AAUGCUGUUCUAUAGAUAGCCCGUA), construyen todo el código de nuestra vida. En un complejísimo código cuya secuencia completa ha sido publicada muy recientemente. Así que de nuevo, sí, son las moléculas más básicas de la vida.

Una técnica que promete mucha más “vida” para el futuro

La terapia con ARN no ha comenzado con estas vacunas, disponibles gracias a Karikó y Weissman y que han salvado millones de vidas. Esa molécula se ha utilizado para otras finalidades y con otras preparaciones previas. El gran logro aquí ha sido el empaquetar estas moléculas tan grandes. Así, se han utilizado desde hace ya algunos años tanto los RNA de interferencia como los llamados “nucleótidos antisentido”, que bloquean la maquinaria celular en diversas enfermedades. Pero nunca producían la síntesis de nuevas proteínas.

Una de las vacunas españolas en desarrollo, la de Luis Enjuanes e Isabel Sola, constituye una mejora sobre este diseño de las de BioNtech y Moderna. Por dos razones: contiene el material genético del virus completo (y no solo el fragmento de la proteína espiga), y además se podrá autocopiar en nuestras células de modo controlado. Su administración sería diferente de las actuales, por vía intranasal.

Con los cambios introducidos gracias al trabajo de los premiados, al menos la compañía Moderna está desarrollando desde hace años decenas de productos que incluyen vacunas para muchos otros agentes infecciosos –incluido el VIH, que hasta ahora se ha resistido–, tratamientos para otras enfermedades inmunitarias y terapias antitumorales. El desarrollo de Karikó y Weissman sin duda ha supuesto un antes y un después en la medicina personalizada. Porque, además, el ARN se puede modificar en muy pocos días en el laboratorio, y escalarse la nueva molécula a producción industrial con celeridad. Esto permitirá que las vacunas estén actualizadas para las variantes circulantes más frecuentes.

Y queda aún un reto importante para esta estrategia vacunal: conseguir preparaciones más estables que no necesiten refrigerarse a muchos grados bajo cero, pues esto dificulta enormemente su distribución masiva y la conservación en países en vías de desarrollo.

Alfredo Corell Almuzara, Catedrático de inmunología, Universidad de Sevilla

Este artículo fue publicado originalmente en The Conversation. Lea el original.

¿Qué te ha parecido este artículo?

¡Gracias por tus feedbacks!

¿Has visto un error de redacción o tienes alguna sugerencia?

Los medios de comunicación independientes no se financia con partidos ni subvenciones, lo hacen sus lectores. Si crees en un periodismo libre e independiente, únete a Diario de España.

The Conversation es un medio de comunicación sin ánimo de lucro que publica noticias e investigaciones en línea, incluyendo la opinión y el análisis de expertos.​Los artículos están escritos exclusivamente por académicos e investigadores

Deja una respuesta

Enable Notifications OK No thanks